Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLJM60-FLAG-SLC38A9.1 (delta110)
(Plasmid #71861)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 71861 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLJM60
  • Backbone size w/o insert (bp) 8613
  • Total vector size (bp) 9969
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SLC38A9.1
  • Alt name
    URLC11
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1686
  • Mutation
    codon optimized, missing first 110 amino acids
  • GenBank ID
    NM_173514.3
  • Entrez Gene
    SLC38A9 (a.k.a. URLC11)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sal1 (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer pLJM-F ATGTCGTAACAACTCCGCCCCATT
  • 3′ sequencing primer pLJM-R TAGTTTGTATGTCTGTTGCTATTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLJM60-FLAG-SLC38A9.1 (delta110) was a gift from David Sabatini (Addgene plasmid # 71861 ; http://n2t.net/addgene:71861 ; RRID:Addgene_71861)
  • For your References section:

    Metabolism. Lysosomal amino acid transporter SLC38A9 signals arginine sufficiency to mTORC1. Wang S, Tsun ZY, Wolfson RL, Shen K, Wyant GA, Plovanich ME, Yuan ED, Jones TD, Chantranupong L, Comb W, Wang T, Bar-Peled L, Zoncu R, Straub C, Kim C, Park J, Sabatini BL, Sabatini DM. Science. 2015 Jan 9;347(6218):188-94. doi: 10.1126/science.1257132. Epub 2015 Jan 7. 10.1126/science.1257132 PubMed 25567906