pdCas9-DNMT3A-PuroR_hNT
(Plasmid #71830)

• Purpose: Expression of dCas9-DNMT3A fusion with T2A-PuroR and non-targeting control sgRNA for use in human cells
• Depositing Lab: Vlatka Zoldoš
• Publication: Vojta et al Nucleic Acids Res. 2016 Mar 11. pii: gkw159.

Backbone

• Vector backbone: pdCas9-DNMT3A-PuroR
• Backbone size w/o insert (bp): 10134
• Total vector size (bp): 10154
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Non-targeting sgRNA human
• Alt name: dCas9-DNMT3A-PuroR_hNT
• Alt name: SpdCas9-DNMT3A-T2A-PuroR_hNT
• Alt name: dCas9-DNMT3A_hNT
• gRNA/shRNA sequence: Non-targeting
• Species: H. sapiens (human), Synthetic; S. pyogenes
• Insert Size (bp): 5906
• Mutation: D10A and H840A in S.pyogenes Cas9
• GenBank ID: AKA60242.1 NP_072046.2
• Entrez Gene: DNMT3A (a.k.a. DNMT3A2, HESJAS, M.HsaIIIA, TBRS)
• Promoter: U6
• Tags / Fusion Proteins:
  • 3xFLAG (N terminal on insert)
  • SV40 NLS (N terminal on insert)
  • T2A-PuroR (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: GAGGGCCTATTTCCCATGATTCC

Resource Information

• Supplemental Documents:
  • pdCas9-DNMT3A-PuroR_hNT annotated GenBank file
• A portion of this plasmid was derived from a plasmid made by: The plasmid is derived from Addgene plasmids #35521 and #48141.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The catalytic domain of human DNMT3A (amino acids P602-V912) was derived from the plasmid pcDNA3/Myc-DNMT3A (Addgene, plasmid #35521) (Chen et al., 2005, J Cell Biochem 95: 902-917). Undesired BbsI restriction site was removed by site-directed mutagenesis, without affecting the amino acid sequence.
Plasmid pSpCas9n(BB)-2A-Puro (PX462) (Addgene, plasmid #48141) (Ran et al., 2013, Nat Protoc 8: 2281-2308) was used as a backbone. Additional H840A mutation was introduced into Cas9n D10A nickase.
Human non-targeting sgRNA is cloned between BbsI restriction sites.