p405-BrdU-Inc
(Plasmid #71791)

• Purpose: BrdU-incorporating plasmid with selectable marker LEU2
• Depositing Lab: Oscar Aparicio
• Publication: Viggiani et al Yeast. 2006 Oct-Nov;23(14-15):1045-51.

Backbone

• Vector backbone: pRS405
• Backbone size w/o insert (bp): 5504
• Total vector size (bp): 11498
• Vector type: Yeast Expression
• Selectable markers: LEU2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Thymidine Kinase
• Species: Herpers Simplex Virus
• Insert Size (bp): 2100
• GenBank ID: J02224.1
• Promoter: GPD

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: cgccagggttttcccagtcacgac

Gene/Insert 2

• Gene/Insert name: ENT1
• Species: H. sapiens (human)
• Insert Size (bp): 1300
• GenBank ID: AF079117.1
• Entrez Gene: SLC29A1 (a.k.a. AUG, ENT1, hENT1)
• Promoter: ADH1

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: ClaI (not destroyed)
• 5′ sequencing primer: cgccagggttttcccagtcacgac
• 3′ sequencing primer: agcggataacaatttcacacagg

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: HSV-TK from E. Schwob hENT1 from C. Cass
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry