Skip to main content
Addgene

pOT2 3GLA
(Plasmid #71764)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 71764 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    unknown
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer T7
  • 3′ sequencing primer hsp70-R2 (CGACGTGTTCACTTTGCTTG)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the full plasmid sequence contains a few differences compared to GenBank ID: KM977569. These differences do not affect the function of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOT2 3GLA was a gift from Matthias Soller (Addgene plasmid # 71764 ; http://n2t.net/addgene:71764 ; RRID:Addgene_71764)
  • For your References section:

    Plasmid-based gap-repair recombineered transgenes reveal a central role for introns in mutually exclusive alternative splicing in Down Syndrome Cell Adhesion Molecule exon 4. Haussmann IU, Ustaoglu P, Brauer U, Hemani Y, Dix TC, Soller M. Nucleic Acids Res. 2018 Dec 12. pii: 5239037. doi: 10.1093/nar/gky1254. 10.1093/nar/gky1254 PubMed 30541104