pUC 3GLA UAS HAi
(Plasmid
#71763)
-
Purpose(Empty Backbone) gap-repair recombineering for Drosophila transgenesis, contains loxP cassette with GFP, Amp resistant, with 5xUAS and HA tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 71763 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneunknown
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer pBR322ori-F (GGGAAACGCCTGGTATCTTT)
- 3′ sequencing primer hsp70-R2 (CGACGTGTTCACTTTGCTTG) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the full plasmid sequence contains a few differences compared to GenBank ID: KM253740. These differences do not affect the function of the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC 3GLA UAS HAi was a gift from Matthias Soller (Addgene plasmid # 71763 ; http://n2t.net/addgene:71763 ; RRID:Addgene_71763) -
For your References section:
Plasmid-based gap-repair recombineered transgenes reveal a central role for introns in mutually exclusive alternative splicing in Down Syndrome Cell Adhesion Molecule exon 4. Haussmann IU, Ustaoglu P, Brauer U, Hemani Y, Dix TC, Soller M. Nucleic Acids Res. 2018 Dec 12. pii: 5239037. doi: 10.1093/nar/gky1254. 10.1093/nar/gky1254 PubMed 30541104