pG1AK-PheB
(Plasmid #71738)

• Purpose: Modular shuttle vector for Geobacillus and E. coli
• Depositing Lab: Tom Ellis
• Publication: Reeve et al ACS Synth Biol. 2016 Jul 1.

Backbone

• Vector backbone: pG1AK
• Backbone size w/o insert (bp): 4719
• Total vector size (bp): 5873
• Vector type: Bacterial Expression, Synthetic Biology ; Shuttle Vector

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Kanamycin, 100 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PheB
• Alt name: Catechol-2,3-dioxygenase
• Species: Geobacillus stearothermophilus
• Insert Size (bp): 915
• Promoter: pRplsWT

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: -
• 3′ sequencing primer: AGCGGATAACAATTTCACACAGGA

Resource Information

• Supplemental Documents:
  • pG1AK-PheB Genbank
• A portion of this plasmid was derived from a plasmid made by: The Leak lab, (Department of Biology & Biochemistry, University of Bath). Part of these plasmids are from pUCG18.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmid from the Geobacillus plasmid set - a modular shuttle vector toolkit for thermophile metabolic engineering