-
PurposeExpressing a GFP-tagged degron in the soma of C. elegans
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 71719 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCFJ151
- Backbone size w/o insert (bp) 7373
- Total vector size (bp) 9593
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameauxin-responsive protein IAA17
-
Alt nameIAA17
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)135
-
Mutationminimal degron sequence (71-114aa) with start codon
-
Entrez GeneAXR3 (a.k.a. AT1G04250, AUXIN RESISTANT 3, AtIAA17, F19P19.31, F19P19_31, IAA17, indole-3-acetic acid inducible 17)
- Promoter eef-1A.1 (eft-3)
-
Tag
/ Fusion Protein
- EmGFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGCCTAAAGATCCAGCCAAACCTCC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLZ29 (pCFJ151_Peft-3_degron_EmGFP_unc-54 3'UTR) was a gift from Abby Dernburg (Addgene plasmid # 71719 ; http://n2t.net/addgene:71719 ; RRID:Addgene_71719) -
For your References section:
The auxin-inducible degradation (AID) system enables versatile conditional protein depletion in C. elegans. Zhang L, Ward JD, Cheng Z, Dernburg AF. Development. 2015 Nov 9. pii: dev.129635. 10.1242/dev.129635 PubMed 26552885