Skip to main content
Addgene

pdCas9-DNMT3A-EGFP (ANV)
(Plasmid #71685)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 71685 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PX462
  • Backbone size w/o insert (bp) 4246
  • Total vector size (bp) 10266
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    S. pyogenes dCas9 fused with the inactivated (E756A) catalytic domain of human DNMT3A (amino acids P602-V912) and T2A-EGFP
  • Alt name
    dCas9-DNMT3A-EGFP (ANV)
  • Alt name
    SpdCas9-DNMT3A-T2A-EGFP (ANV)
  • Alt name
    6020
  • Species
    H. sapiens (human), Synthetic; S. pyogenes
  • Mutation
    D10A and H840A in S.pyogenes Cas9; E756A inactivating mutation in H. sapiens DNMT3A
  • GenBank ID
    AKA60242.1 NP_072046.2
  • Entrez Gene
    DNMT3A (a.k.a. DNMT3A2, HESJAS, M.HsaIIIA, TBRS)
  • Promoter CBh
  • Tags / Fusion Proteins
    • 3xFLAG (N terminal on insert)
    • SV40 NLS (N terminal on insert)
    • T2A-EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site FseI (not destroyed)
  • 5′ sequencing primer GS-linker For 5' GAAGAGGTACACCAGCACCAAAG 3'
  • 3′ sequencing primer BGH Rev
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The catalytic domain of human DNMT3A (amino acids P602-V912) was derived from the plasmid pcDNA3/Myc-DNMT3A (Addgene, plasmid #35521) (Chen et al., 2005, J Cell Biochem 95: 902-917). Undesired BbsI restriction site was removed by site-directed mutagenesis, without affecting the amino acid sequence. The DNMT3A active site motif ENV was mutated to ANV (E756A).
Plasmid pSpCas9n(BB)-2A-Puro (PX462) (Addgene, plasmid #48141) (Ran et al., 2013, Nat Protoc 8: 2281-2308) was used as a backbone. Additional H840A mutation was introduced into Cas9n D10A nickase. T2A-PuroR EcoRI fragment was replaced with T2A-EGFP fragment from pSpCas9n(BB)-2A-GFP (PX461) (Addgene, plasmid #48140) (Ran et al., 2013, Nat Protoc 8: 2281-2308).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pdCas9-DNMT3A-EGFP (ANV) was a gift from Vlatka Zoldoš (Addgene plasmid # 71685 ; http://n2t.net/addgene:71685 ; RRID:Addgene_71685)
  • For your References section:

    Repurposing the CRISPR-Cas9 system for targeted DNA methylation. Vojta A, Dobrinic P, Tadic V, Bockor L, Korac P, Julg B, Klasic M, Zoldos V. Nucleic Acids Res. 2016 Mar 11. pii: gkw159. 10.1093/nar/gkw159 PubMed 26969735