-
PurposeContains 600 bp homology arms to SS9 for one-step markerless genome integration in E. coli
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 71655 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBR322
-
Backbone manufacturerNew England Biolabs
- Backbone size w/o insert (bp) 4751
- Total vector size (bp) 5662
-
Modifications to backboneBackbone has 600 bp homology arms for integration into SS9. The upstream (5') homology contains a PAM mutation to inactive SS9_gRNA cleavage.
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegfpuv
-
SpeciesSynthetic; Cloning vector pGFPuv
-
Insert Size (bp)911
-
GenBank IDU62636.1
- Promoter T7A1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGTGACAAAAATAAATTATTTATTTATCCAGAAAATGAATTGGAAAATC
- 3′ sequencing primer CACATACTTATTATGAATGATAAAATTCATTCAATTAATAACAC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSS9 was a gift from Ryan Gill (Addgene plasmid # 71655 ; http://n2t.net/addgene:71655 ; RRID:Addgene_71655) -
For your References section:
Rapid and Efficient One-Step Metabolic Pathway Integration in E. coli. Bassalo MC, Garst AD, Halweg-Edwards AL, Grau WC, Domaille DW, Mutalik VK, Arkin AP, Gill RT. ACS Synth Biol. 2016 Apr 22. 10.1021/acssynbio.5b00187 PubMed 27072506