Skip to main content
Addgene

pAAV-hSynI-mCherry-F2A-TVA-T2A-RabG-WPRE-hGH poly (A) (Alex_03)
(Plasmid #71654)

Print

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 71654 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV-hSynI-mCherry-WPRE-hGH poly(A) (ID 71650)
  • Backbone manufacturer
    Aleksandar Bajic
  • Backbone size w/o insert (bp) 5268
  • Total vector size (bp) 7460
  • Vector type
    Mammalian Expression, AAV ; Rabies virus

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    F2A-TVA-T2A-RabG
  • Species
    Rabies virus
  • Insert Size (bp)
    2218
  • Promoter hSynI

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsrGI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CATGGACGAGCTGTACAAGG
  • 3′ sequencing primer GCATTAAAGCAGCGTATCCAC
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The inserted cassette was subcloned from Addgene #30195 plasmid. Depositing labs: Edward Callaway and Liqun Luo

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid made by Aleksandar Bajic. Human IPSCs derived neurons were lipofected with this plasmid and subsequently efficiently infected with rabies viruses to trace neuronal networks.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSynI-mCherry-F2A-TVA-T2A-RabG-WPRE-hGH poly (A) (Alex_03) was a gift from Mirjana Maletić-Savatić (Addgene plasmid # 71654 ; http://n2t.net/addgene:71654 ; RRID:Addgene_71654)
Related items: