pKM342
(Plasmid #71486)

• Purpose: Contains loxP-hyg-loxP cassette for recombineering; HygR, AmpR.
• Depositing Lab: Kenan Murphy
• Publication: Murphy et al Methods Mol Biol. 2015;1285:177-99. doi: 10.1007/978-1-4939-2450-9_10.

Backbone

• Vector backbone: pKM328
• Backbone manufacturer: Kenan Murphy
• Backbone size w/o insert (bp): 2741
• Total vector size (bp): 4035
• Modifications to backbone: Insertion of loxP-Hyg-logP cassette
• Vector type: Bacterial Expression ; Source of loxP-hyg-loxP for PCR amplification.
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: loxP-hyg-loxP cassette
• Species: Synthetic
• Insert Size (bp): 1231

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: AscI (not destroyed)
• 5′ sequencing primer: GGGATGTGCTGCAAGGCGATT
• 3′ sequencing primer: GCACCCCAGGCTTTACACTTT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: J. Murry from Eric Rubin's lab. The loxP-hyg-loxP cassette was derived from plasmid pJM1.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The floxed hyg cassette is flanked by AscI sites, which can be recovered by restriction digestion for use in the construction of recombineering substrates, or amplified by PCR using the following targeting sequences:
CGCTCTAGAACTAGTGGATCC
ATGCCTGCAGGTCGACTC