Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKM342
(Plasmid #71486)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 71486 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pKM328
  • Backbone manufacturer
    Kenan Murphy
  • Backbone size w/o insert (bp) 2741
  • Total vector size (bp) 4035
  • Modifications to backbone
    Insertion of loxP-Hyg-logP cassette
  • Vector type
    Bacterial Expression ; Source of loxP-hyg-loxP for PCR amplification.
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    loxP-hyg-loxP cassette
  • Species
    Synthetic
  • Insert Size (bp)
    1231

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer GGGATGTGCTGCAAGGCGATT
  • 3′ sequencing primer GCACCCCAGGCTTTACACTTT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    J. Murry from Eric Rubin's lab. The loxP-hyg-loxP cassette was derived from plasmid pJM1.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The floxed hyg cassette is flanked by AscI sites, which can be recovered by restriction digestion for use in the construction of recombineering substrates, or amplified by PCR using the following targeting sequences:
CGCTCTAGAACTAGTGGATCC
ATGCCTGCAGGTCGACTC

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKM342 was a gift from Kenan Murphy (Addgene plasmid # 71486 ; http://n2t.net/addgene:71486 ; RRID:Addgene_71486)
  • For your References section:

    Mycobacterial recombineering. Murphy KC, Papavinasasundaram K, Sassetti CM. Methods Mol Biol. 2015;1285:177-99. doi: 10.1007/978-1-4939-2450-9_10. 10.1007/978-1-4939-2450-9_10 PubMed 25779316