-
PurposeLentiviral expression of WT-STAT1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 71454 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLV-tetO-CMV-SV40-puro-LoxP
-
Backbone manufacturerAndrei Gudkov lab
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSTAT1
-
SpeciesH. sapiens (human)
-
Entrez GeneSTAT1 (a.k.a. CANDF7, IMD31A, IMD31B, IMD31C, ISGF-3, STAT91)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer GGAGTTTGTTTTGGCACCA
- 3′ sequencing primer CTCTTTCAGAGGTTATTTCAGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-WT-STAT1 was a gift from George Stark (Addgene plasmid # 71454 ; http://n2t.net/addgene:71454 ; RRID:Addgene_71454) -
For your References section:
Unphosphorylated STAT1 prolongs the expression of interferon-induced immune regulatory genes. Cheon H, Stark GR. Proc Natl Acad Sci U S A. 2009 Jun 9;106(23):9373-8. doi: 10.1073/pnas.0903487106. Epub 2009 May 28. 10.1073/pnas.0903487106 PubMed 19478064