Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLV-IRF9
(Plasmid #71452)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 71452 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLV-tetO-CMV-SV40-puro-LoxP
  • Backbone manufacturer
    Andrei Gudkov lab
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    IRF9
  • Species
    H. sapiens (human)
  • Entrez Gene
    IRF9 (a.k.a. IRF-9, ISGF3, ISGF3G, p48)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer GGAGTTTGTTTTGGCACCA
  • 3′ sequencing primer CTCTTTCAGAGGTTATTTCAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-IRF9 was a gift from George Stark (Addgene plasmid # 71452 ; http://n2t.net/addgene:71452 ; RRID:Addgene_71452)
  • For your References section:

    IFNbeta-dependent increases in STAT1, STAT2, and IRF9 mediate resistance to viruses and DNA damage. Cheon H, Holvey-Bates EG, Schoggins JW, Forster S, Hertzog P, Imanaka N, Rice CM, Jackson MW, Junk DJ, Stark GR. EMBO J. 2013 Oct 16;32(20):2751-63. doi: 10.1038/emboj.2013.203. Epub 2013 Sep 24. 10.1038/emboj.2013.203 PubMed 24065129