pMIG-FLAG-MLL-AF9
(Plasmid #71443)

• Purpose: Retroviral construct to express FLAG-tagged MLL-AF9 fusion gene, followed by IRES-GFP
• Depositing Lab: Daisuke Nakada
• Publication: Saito et al Cell Stem Cell. 2015 Sep 29. pii: S1934-5909(15)00374-4. doi: 10.1016/j.stem.2015.08.019.

Backbone

• Vector backbone: pMIGL
• Backbone size w/o insert (bp): 6600
• Total vector size (bp): 11100
• Vector type: Mammalian Expression, Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: MLL-Af9
• Species: H. sapiens (human)
• Insert Size (bp): 4500
• Entrez Gene: KMT2A (a.k.a. ALL-1, ALL1, CXXC7, GAS7, HRX, HTRX, HTRX1, MLL, MLL1, MLL1A, TRX1, WDSTS)
• Promoter: MSCV
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HpaI (destroyed during cloning)
• 3′ cloning site: NsiI (not destroyed)
• 5′ sequencing primer: cccttgaacctcctcgttcgacc
• 3′ sequencing primer: CCAAAAGACGGCAATATGGT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Jay Hess (University of Michigan)
• Articles Citing this Plasmid:
  • 16 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry