pAAV-flex-rev-g2-2A-Venus
(Plasmid #71410)

• Purpose: This plasmid is pAAV-panpromoter-flex-rev-gamma2F77-2A-Venus. Confers zolpidem sensitivity on zolpidem-insensitive neurons.
• Depositing Lab: William Wisden
• Publication: Uygun et al J Neurosci. 2016 Nov 2;36(44):11171-11184.

Backbone

• Vector backbone: pUC
• Backbone size w/o insert (bp): 3000
• Total vector size (bp): 7748
• Vector type: Mammalian Expression, AAV, Cre/Lox
• Promoter: mouse hdc gene promoter, works as a pan neuronal promoter

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: ACGCTGAACTTGTGGCCGTTTA
• 3′ sequencing primer: TTTTGCTTGTTCAATCTTGTTTA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: This plasmid was constructed from two others: pAAV-CAG-promoter-Cre-2A-gamma22F77, kindly provided by Zoltan Nusser, Institute of Experimental Medicine, Hungarian Academy of Sciences, Budapest, Hungary (Sumegi M., et al., 2012, J Physiol 590: 1517); and pAAV-flex-rev-hM4-mCherry (Addgene plasmid 44362, gift of Bryan Roth, University of North Carolina at Chapel Hill, USA; (Krashes MJ et al., 2011, J Clin Invest 121: 1424). The promoter fragment from the mouse hdc gene is unpublished, but we found it works as a panneuronal promoter, although it was intended to be selective for histaminergic neurons.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid allows the introduction of zolpidem sensitivity into non-zolpidem senstive neurons. It has to be used in conjuction with the mouse line gabrg2I77lox (deposited in JAX labs, stock number, https://www.jax.org/strain/021197 (Gabrg2tm1Wul).

This plasmid was constructed from two others: pAAV-CAG-promoter-Cre-2A-gamma22F77, kindly provided by Zoltan Nusser, Institute of Experimental Medicine, Hungarian Academy of Sciences, Budapest, Hungary (Sumegi M., et al., 2012, J Physiol 590: 1517); and pAAV-flex-rev-hM4-mCherry (Addgene plasmid 44362, gift of Bryan Roth, University of North Carolina at Chapel Hill, USA; (Krashes MJ et al., 2011, J Clin Invest 121: 1424). The promoter fragment from the mouse hdc gene is unpublished, but we found it works as a panneuronal promoter, although it was intended to be selective for histaminergic neurons.