pFUGW-Pol2-ffLuc2-eGFP
(Plasmid #71394)

• Purpose: Lentiviral vector of luciferase-eGFP fusion gene driven by Pol2 promoter
• Depositing Lab: Glenn Merlino
• Publication: Day et al Pigment Cell Melanoma Res. 2009 Jun;22(3):283-95. doi: 10.1111/j.1755-148X.2009.00545.x. Epub 2009 Jan 19.

Backbone

• Vector backbone: pFUGW
• Backbone size w/o insert (bp): 5828
• Total vector size (bp): 9031
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: None

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Grow at 30 degrees and no more than 16 hours to maintain lentiviral LTR repeats
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Pol2-ffLuc2-eGFP
• Alt name: mouse RNA polymerase II promoter- firefly luciferase-eGFP fusion gene
• Species: M. musculus (mouse); firefly and jellyfish
• Insert Size (bp): 3122
• Promoter: Pol2 (mouse RNA polymerase II gene promtoer)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: ATCCATTCGATTAGTGAACGG
• 3′ sequencing primer: GCCATACGGGAAGCAATAGC

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: eGFP gene was synthetically produced. FerH promoter was amplified from a plasmid from Invivogen
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry