pGC629
(Plasmid #71364)

• Purpose: proximal somatic gonad expression of DAF-16 in C.elegans
• Depositing Lab: Jane Hubbard
• Publication: Qin et al Nat Commun. 2015 May 11;6:7107. doi: 10.1038/ncomms8107.

Backbone

• Vector backbone: pNL205
• Backbone manufacturer: Libina, et al. 2003. PMID 14622602
• Total vector size (bp): 13565
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: daf-16
• Species: C. elegans (nematode)
• Entrez Gene: daf-16 (a.k.a. CELE_R13H8.1)
• Promoter: fos1a promoter
• Tag / Fusion Protein:
  • GFP(65C) (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GFP-F (GGTCCTTCTTGAGTTTGTAAC)
• 3′ sequencing primer: T7

Resource Information

• A portion of this plasmid was derived from a plasmid made by: fos1a promoter was PCR amplified from pBSfos-1p (a kind gift from David Sherwood).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry