pGC461
(Plasmid
#71363)
-
Purposedistal tip cell expression of DAF-16 in C. elegans
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 71363 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJK590
-
Backbone manufacturerBlelloch et al., 1999; Mathies et al., 2003
- Total vector size (bp) 9483
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedaf-16
-
SpeciesC. elegans (nematode)
-
Entrez Genedaf-16 (a.k.a. CELE_R13H8.1)
- Promoter Blelloch et al., 1999; Mathies et al., 2003
-
Tag
/ Fusion Protein
- GFP(65C) (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer unknown
- 3′ sequencing primer GFP-R (CCATCTAATTCAACAAGAATTGGGACAAC) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bydaf-16::GFP fusion was a gift of T. Johnson
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGC461 was a gift from Jane Hubbard (Addgene plasmid # 71363 ; http://n2t.net/addgene:71363 ; RRID:Addgene_71363) -
For your References section:
Insulin signaling promotes germline proliferation in C. elegans. Michaelson D, Korta DZ, Capua Y, Hubbard EJ. Development. 2010 Feb;137(4):671-80. doi: 10.1242/dev.042523. 10.1242/dev.042523 PubMed 20110332