Mito-Cyan Nano-lantern(Ca2+)/pcDNA3
(Plasmid
#71345)
-
PurposeExpress Mito-Cyan Nano-lantern-based luminescent Ca2+ indicator in mammalian cel
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 71345 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehOTC_Cyan Nano-lantern(Ca2+)
-
SpeciesSynthetic
-
Insert Size (bp)2277
-
GenBank IDAB983215
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GAAATTAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Mito-Cyan Nano-lantern(Ca2+)/pcDNA3 was a gift from Takeharu Nagai (Addgene plasmid # 71345 ; http://n2t.net/addgene:71345 ; RRID:Addgene_71345) -
For your References section:
Expanded palette of Nano-lanterns for real-time multicolor luminescence imaging. Takai A, Nakano M, Saito K, Haruno R, Watanabe TM, Ohyanagi T, Jin T, Okada Y, Nagai T. Proc Natl Acad Sci U S A. 2015 Apr 7;112(14):4352-6. doi: 10.1073/pnas.1418468112. Epub 2015 Mar 23. 10.1073/pnas.1418468112 PubMed 25831507
Map uploaded by the depositor.
![](https://media.addgene.org/data/easy-thumbnails/data/plasmids/71/71345/71345-map_SwDAKjv3fUuf.pdf.940x940_q85_autocrop.png)