Skip to main content
Addgene

pTRIPZ-hDDX5/17
(Plasmid #71307)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 71307 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pTRIPZ
  • Backbone manufacturer
    GE - Dharmacon
  • Backbone size w/o insert (bp) 13362
  • Total vector size (bp) 13406
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin, Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    DDX5/17 shRNA
  • gRNA/shRNA sequence
    AGGGCTAGATGTGGAAGATGT
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_004396 NM_001098504, NM_006386
  • Entrez Gene
    DDX17 (a.k.a. P72, RH70)
  • Promoter TetO

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer 5’-GGAAAGAATCAAGGAGG-3’
  • 3′ sequencing primer 5'-TCTGACGTGGCAGCGCTCGCC-3'
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRIPZ-hDDX5/17 was a gift from Allan Brasier (Addgene plasmid # 71307 ; http://n2t.net/addgene:71307 ; RRID:Addgene_71307)

  • For your References section:

    Systematic Determination of Human Cyclin Dependent Kinase (CDK)-9 Interactome Identifies Novel Functions in RNA Splicing Mediated by the DEAD Box (DDX)-5/17 RNA Helicases. Yang J, Zhao Y, Kalita M, Li X, Jamaluddin M, Tian B, Edeh CB, Wiktorowicz JE, Kudlicki A, Brasier AR. Mol Cell Proteomics. 2015 Oct;14(10):2701-21. doi: 10.1074/mcp.M115.049221. Epub 2015 Jul 24. 10.1074/mcp.M115.049221 PubMed 26209609
Related items:
Commonly requested with: