Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

HSP70l-APEX2-GBP in pDEST-Tol2-pA2-acrys-mCherry
(Plasmid #71282)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 71282 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDEST-Tol2-pA2 acrys-mCherry
  • Vector type
    Zebrafish expression with Tol2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    APEX2-GBP
  • Species
    Synthetic
  • Promoter HSP70l

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CCCAACTGTGAGTGCTGATT
  • 3′ sequencing primer TTGGTGAGCCTCAGCGTAAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HSP70l-APEX2-GBP in pDEST-Tol2-pA2-acrys-mCherry was a gift from Rob Parton (Addgene plasmid # 71282 ; http://n2t.net/addgene:71282 ; RRID:Addgene_71282)
  • For your References section:

    Modular Detection of GFP-Labeled Proteins for Rapid Screening by Electron Microscopy in Cells and Organisms. Ariotti N, Hall TE, Rae J, Ferguson C, McMahon KA, Martel N, Webb RE, Webb RI, Teasdale RD, Parton RG. Dev Cell. 2015 Nov 23;35(4):513-25. doi: 10.1016/j.devcel.2015.10.016. Epub 2015 Nov 12. 10.1016/j.devcel.2015.10.016 PubMed 26585296