Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p2R3a-GUS-OcsT
(Plasmid #71267)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 71267 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    p2RP3-pGEMteasy
  • Backbone manufacturer
    ampicillin resistant variant of pDONR-P2R-P3. attP2R-ccdB-cmR-attP3 sequences of pDONR-P2R-P3 were cloned into pGEMt-easy
  • Vector type
    Gateway

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Beta-glucuronidase
  • Alt name
    GUS
  • Insert Size (bp)
    2600
  • Tags / Fusion Proteins
    • 2xGly linker (N terminal on insert)
    • octaline synthase terminator (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer M13pUC-Fwd
  • 3′ sequencing primer OCSterm-R (GGCGGTAAGGATCTGAGCTA)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p2R3a-GUS-OcsT was a gift from Ari Pekka Mähönen (Addgene plasmid # 71267 ; http://n2t.net/addgene:71267 ; RRID:Addgene_71267)
  • For your References section:

    MultiSite Gateway compatible cell type-specific gene inducible system for plants. Siligato R, Wang X, Yadav SR, Lehesranta S, Ma G, Ursache R, Sevilem I, Zhang J, Gorte M, Prasad K, Wrzaczek M, Heidstra R, Murphy A, Scheres B, Mahonen AP. Plant Physiol. 2015 Dec 7. pii: pp.01246.2015. 10.1104/pp.15.01246 PubMed 26644504