p2R3a-GUS-OcsT
(Plasmid #71267)

• Purpose: Entry clone containing the GUS enzyme. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway system
• Depositing Lab: Ari Pekka Mähönen
• Publication: Siligato et al Plant Physiol. 2015 Dec 7. pii: pp.01246.2015.

Backbone

• Vector backbone: p2RP3-pGEMteasy
• Backbone manufacturer: ampicillin resistant variant of pDONR-P2R-P3. attP2R-ccdB-cmR-attP3 sequences of pDONR-P2R-P3 were cloned into pGEMt-easy
• Vector type: Gateway

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Beta-glucuronidase
• Alt name: GUS
• Insert Size (bp): 2600
• Tags / Fusion Proteins:
  • 2xGly linker (N terminal on insert)
  • octaline synthase terminator (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: M13pUC-Fwd
• 3′ sequencing primer: OCSterm-R (GGCGGTAAGGATCTGAGCTA)

Resource Information

• Supplemental Documents:
  • p2R3a-GUS-OcsT genbank

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry