pETM6-HpaBC
(Plasmid
#71260)
-
PurposeExpresses E. coli HpaBC in monocistronic form from ePathBrick vector, pETM6
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 71260 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepETM6
-
Backbone manufacturerAddgene Plasmid # 49795
- Backbone size w/o insert (bp) 5155
- Total vector size (bp) 7381
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameHpaB
-
SpeciesEscherichia coli
-
Insert Size (bp)1563
- Promoter T7
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer gggaaaCATATGAAACCAGAAGATTTCCGCGCCAG
- 3′ sequencing primer gggaaaACTAGTTATTTCAGCAGCTTATCCAGCATGTTGATATCG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHpaC
-
SpeciesEscherichia coli
-
Insert Size (bp)513
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer ATGCAATTAGATGAACAACGCCTGCGC
- 3′ sequencing primer ACTAGTTAAATCGCAGCTTCCATTTCCAGCATCAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pETM6-HpaBC was a gift from Mattheos Koffas (Addgene plasmid # 71260 ; http://n2t.net/addgene:71260 ; RRID:Addgene_71260) -
For your References section:
"Optimization of naringenin and p-coumaric acid hydroxylation using the native E. coli hydroxylase complex, HpaBC". Jones JA, Collins SM, Lachance DM, Vernacchio VR, Koffas MA. Biotechnol Prog. 2015 Oct 21. doi: 10.1002/btpr.2185. 10.1002/btpr.2185 PubMed 26488898