pAP1-3
(Plasmid #71258)

• Purpose: luciferase reporter with 3 copies of the stromelylisin gene AP-1 site in front of hGM-CSF -55 to +28 minimal promoter
• Depositing Lab: Peter Cockerill
• Publication: Cockerill Lab Plasmids (unpublished)

Backbone

• Vector backbone: pGM55
• Backbone manufacturer: Cockerill lab, Addgene plasmid 71249
• Total vector size (bp): 6305
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 3 copies of an AP-1 site from the human Stromelysin-1 gene
• Alt name: matrix metallopeptidase 3
• Species: H. sapiens (human)
• Entrez Gene: MMP3 (a.k.a. CHDS6, MMP-3, SL-1, STMY, STMY1, STR1)
• Promoter: GM-CSF minimal
• Tag / Fusion Protein:
  • luciferase (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: SmaI (destroyed during cloning)
• 5′ sequencing primer: unknown
• 3′ sequencing primer: LucNRev

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Cloned as 3 copies of an oligonucleotide duplex with complementary overhanging BglII ends: AGATCTGGATCACCCGCAGCTTGACTCATCCTTGCAGATCT

Reference for AP-1 site = Cockerill PN, Shannon MF, Bert AG, Ryan GR and Vadas MA. The GM-CSF/IL3 locus is regulated by an inducible cyclosporin A sensitive enhancer. Proc.Natl.Acad.Sci. USA 90, 2466-2470, 1993.

JM109 are the cells used by the author for pXPG and its derivatives.