pAS1NB m Rosella I
(Plasmid #71247)

• Purpose: a biosensor comprised of a fast-maturing pH-stable red fluorescent protein fused to a pH-sensitive green fluorescent protein variant. Mitochodrial localization.
• Depositing Lab: Mark Prescott
• Publication: Rosado et al Autophagy. 2008 Feb;4(2):205-13. Epub 2007 Nov 21.

Backbone

• Vector backbone: pAS1NB
• Total vector size (bp): 9209
• Vector type: Yeast Expression
• Selectable markers: LEU2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Rosella
• Alt name: DsRed.T3
• Alt name: super ecliptic pHluorin (SEP)
• Species: Synthetic
• Promoter: PGK1
• Tag / Fusion Protein:
  • yeast mitochondrial targeting sequence of citrate synthase (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: PPGK1-F (cagcctgttctcacacactc)
• 3′ sequencing primer: yPGK1-term-R (AGCGTAAAGGATGGGGAAAG)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The primer pair CIT2Up (5'‑GAAGATCTAAACAATGTCAG TCGATATTATC) and CIT2Do (5'‑GAGGATCCGTAATTTCA GCAAATCTCTCC) was used to amplify the yeast mitochondrial targeting sequence of citrate synthase flanked by BglII sites from yeast genomic DNA. The resultant PCR fragment, following digestion with BglII, was ligated in‑frame at the 5' end of the Rosella expression cassette.

Note: This plasmid may run as a dimer. It may be helpful to follow protocols for low copy plasmids.