pAS1NB c Rosella I
(Plasmid #71245)

• Purpose: a biosensor comprised of a fast-maturing pH-stable red fluorescent protein fused to a pH-sensitive green fluorescent protein variant. Cytosolic localization.
• Depositing Lab: Mark Prescott
• Publication: Rosado et al Autophagy. 2008 Feb;4(2):205-13. Epub 2007 Nov 21.

Backbone

• Vector backbone: pAS1NB
• Total vector size (bp): 9040
• Vector type: Yeast Expression
• Selectable markers: LEU2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Rosella
• Alt name: DsRed.T3
• Alt name: super ecliptic pHluorin (SEP)
• Species: Synthetic
• Promoter: PGK1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: PPGK1-F (cagcctgttctcacacactc)
• 3′ sequencing primer: yPGK1-term-R (AGCGTAAAGGATGGGGAAAG)

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: Dr B Glick for plasmid pQE31‑DsRed.T3 and Dr J Rothman for plasmid pGEX‑2T‑SEP
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The coding sequence of DsRed.T3 was amplified from pQE31‑DsRed.T326 using the primer pair DsRedTUp2 (5'TAGGATCCCCACTAGTCGCCACCATGGCC TCCTC) and DsRedTDo (5'ATAGTTTAGCGGCCGCTCAGT GATCAGACAGGAACAGGTGGTGG) designed to incorporate 5' BamHI and nested 3' BclI and NotI sites. Following digestion with BamHI and NotI, the amplified gene cassette was subcloned into the multi‑copy yeast expression vector pAS1NB under control of the PGK1 promoter and the resultant vector named pAS1NB‑DsRed.T3. The super ecliptic pHluorin (SEP) gene was amplified from the template pGEX‑2T‑SEP27 using the primer pair PHUp1 (5'GGGATCCTGGTCTTCGGGTGGAAGTAAAGGAG) and PHDo1 (5'‑ATAGTTTAGCGGCCGCTCAGTGATCAGATT TGTATAGTTCATCC) designed to incorporate flanking 5' BamHI and 3' NotI sites. The SEP gene cassette recovered by PCR was digested with BamHI and NotI, and cloned into pAS1NB‑DsRed.T3 digested with BclI and NotI to produce this vector. The expression product from this vector, named the Rosella biosensor, comprises DsRed.T3 fused to SEP with an intervening linker of 9 amino acids (DPWSSSGDL).