Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJBL1864
(Plasmid #71210)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 71210 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Custom
  • Backbone manufacturer
    N/A
  • Total vector size (bp) 3652
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Anti-anti Sense
  • Species
    Synthetic
  • Promoter BBa_J23119

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer aaatgtagcacctgaagtcagcccc
  • 3′ sequencing primer ctcaatgatgatgatgatgatggtc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJBL1864 was a gift from Julius Lucks (Addgene plasmid # 71210 ; http://n2t.net/addgene:71210 ; RRID:Addgene_71210)
  • For your References section:

    Creating small transcription activating RNAs. Chappell J, Takahashi MK, Lucks JB. Nat Chem Biol. 2015 Mar;11(3):214-20. doi: 10.1038/nchembio.1737. Epub 2015 Feb 2. 10.1038/nchembio.1737 PubMed 25643173