pRS416-Gal4-dCas9-VP64
(Plasmid #71128)

• Purpose: This plasmid contains a Cas9 Activator for yeast. The activator is about 1.2-1.8 X more potent than just dCas9-VP64 fusion in yeast. It is on a single copy CEN/ARS plasmid with Ura marker, pRS416.
• Depositing Lab: Ronald Davis
• Publication: Naranjo et al PLoS Genet. 2015 Dec 29;11(12):e1005751. doi: 10.1371/journal.pgen.1005751. eCollection 2015 Dec.

Backbone

• Vector backbone: pRS416
• Backbone size w/o insert (bp): 5000
• Total vector size (bp): 10203
• Vector type: Yeast Expression
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Gal4-dCas9-VP64
• Alt name: Gal4 Activator domain, dCas9, VP64 activator dormain.
• Species: S. cerevisiae (budding yeast), Synthetic; S pyogenes Cas9, S cerevisiae Gal4, Viral/ VP64
• Insert Size (bp): 4725
• Promoter: Tef1
• Tag / Fusion Protein:
  • NLS n-terminal, N terminal Gal4 Activator domain, C terminal VP64

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tcacacaggaaacagctatgaccatg
• 3′ sequencing primer: GTTGTAAAACGACGGCCAGTG

Resource Information

• Supplemental Documents:
  • Benchling plasmid map
  • Fully annotated GenBank Plasmid Map
• A portion of this plasmid was derived from a plasmid made by: Cas9 + promoter and terminator was obtained from DiCarlo et al 2013 from addgene https://www.addgene.org/43802/ . I created the activator version by introducing the D10A and H840A mutations to make dCas9 and then fusing VP64 and S cerevisiae Gal4 activator domains.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry