pCW-Flag-CtIP
(Plasmid #71108)

• Purpose: mammalian expession of Flag-CtlP
• Depositing Lab: Daniel Durocher
• Publication: Orthwein et al Nature. 2015 Dec 9. doi: 10.1038/nature16142.

Backbone

• Vector backbone: pCW57.1
• Backbone manufacturer: David Root; Addgene plasmid #41393
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CtlP
• Species: H. sapiens (human)
• Mutation: Please see Depositor Comments
• Promoter: TRE promoter, Tet ON
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: LNCX
• 3′ sequencing primer: O.PGK1b-R (GAACGGACGTGAAGAATGTG)

Resource Information

• Supplemental Documents:
  • Annotated GenBank file
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

siRNA resistant construct. Custom CtlP siRNA (Dharmacon) sequence: GCUAAAACAGGAACGAAUC

Addgene NGS identified L278I and M544T point mutations within the CtlP insert. The depositing laboratory has confirmed that the plasmid functions as described in their publication