pLV-tetO-Id2
(Plasmid #70764)

• Purpose: Lentiviral plasmid for tetracycline/doxycycline dependent expression of murine Id2
• Depositing Lab: Hubert Schorle
• Publication: Kubaczka et al Cell Stem Cell. 2015 Sep 22. pii: S1934-5909(15)00360-4. doi: 10.1016/j.stem.2015.08.005.

Backbone

• Vector backbone: pLV-tetO
• Backbone manufacturer: Hochedlinger Lab (Stadtfeld et al Cell Stem Cell. 2008 Mar 6. 2(3):230-40.)
• Backbone size w/o insert (bp): 8370
• Total vector size (bp): 8879
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: inhibitor of DNA binding 2
• Alt name: Id2, bHLHb26, C78922, Idb2, inhibitor of differentiation 2
• Species: M. musculus (mouse)
• Insert Size (bp): 509
• GenBank ID: NM_010496
• Entrez Gene: Id2 (a.k.a. Idb2, bHLHb26)
• Promoter: tetO

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (destroyed during cloning)
• 3′ cloning site: EcoRI (destroyed during cloning)
• 5′ sequencing primer: CMV-Promoter F: ACGCCATCCACGCTGTTTTGACCT
• 3′ sequencing primer: WPRE-R: CATAGCGTAAAAGGAGCAACA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The cDNA sequence of murine Id2 was amplified and subcloned into the pCR2.1 vector. From there it was excised via HindIII and EcoRV and inserted into the pLV-tetO vector via the EcoRI site after Klenow treatment of both vector backbone and insert. The pLV-tetO vector backbone was obtained through EcoRI mediated excision of Oct4 cDNA from pLV-tetO-Oct4 (Stadtfeld et al., 2008, addgene Plasmid #19766), kindly provided by K. Hochedlinger (Harvard University).