-
Purposeexpresses Ustilago maydis codon-optimized Cas9, contains U. maydis U6 promoter, is self-replicating
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 70763 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepNEBUC
-
Backbone manufacturerWeinzierl et al., 2002, Mol. Microbiol. 45
- Total vector size (bp) 11105
-
Vector typeself-replicating in Ustilago maydis, conferring carboxin resistance
-
Selectable markerscarboxin resistance conferred by mutated ip gene
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameU6 promoter
-
SpeciesUstilago maydis
-
Insert Size (bp)826
- Promoter U6 from Ustilago maydis
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site Acc651 (not destroyed)
- 5′ sequencing primer TACGCCAAGCTTTAATACGTTCGTTCCG
- 3′ sequencing primer GGTACGGGTACCGTTGTAGAATGGAATTTTG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namecas9
-
SpeciesSynthetic
-
Insert Size (bp)5393
-
MutationStreptococcus pyogenes gene codon-optimized for Ustilago maydis
- Promoter synthetic otef promoter (Spellig et al., 1996, Mol. Gen. Genet. 252)
-
Tag
/ Fusion Protein
- N-terminal NLS, C-terminal HA-tag +NLS (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TACGCCAAGCTTTAATACGTTCGTTCCG
- 3′ sequencing primer GTAAAACGACGGCCAG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nametnos terminator
-
SpeciesAgrobacterium tumefaciens
-
Insert Size (bp)291
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCas9_sgRNA_0 was a gift from Regine Kahmann (Addgene plasmid # 70763 ; http://n2t.net/addgene:70763 ; RRID:Addgene_70763) -
For your References section:
Genome editing in Ustilago maydis using the CRISPR-Cas system. Schuster M, Schweizer G, Reissmann S, Kahmann R. Fungal Genet Biol. 2015 Sep 11. pii: S1087-1845(15)30025-6. doi: 10.1016/j.fgb.2015.09.001. 10.1016/j.fgb.2015.09.001 PubMed 26365384