Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAV-mOXT-hM3Dq-mCherry-WPRE
(Plasmid #70717)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 70717 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 5142
  • Total vector size (bp) 7600
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    hM3Dq-mCherry
  • Alt name
    DREADDs-mCherry
  • Species
    H. sapiens (human), Synthetic
  • Promoter mouse oxytocin
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GTTATGCTAGCGCCACCATG
  • 3′ sequencing primer TTACTTGTACAGCTCGTCCATG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This plasmid is derived as a modification from Addgene Plasmid #44361 - pAAV-hSyn-DIO-hM3D(Gq)-mCherry.
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-mOXT-hM3Dq-mCherry-WPRE was a gift from Daniel Geschwind (Addgene plasmid # 70717 ; http://n2t.net/addgene:70717 ; RRID:Addgene_70717)
  • For your References section:

    Exogenous and evoked oxytocin restores social behavior in the Cntnap2 mouse model of autism. Penagarikano O, Lazaro MT, Lu XH, Gordon A, Dong H, Lam HA, Peles E, Maidment NT, Murphy NP, Yang XW, Golshani P, Geschwind DH. Sci Transl Med. 2015 Jan 21;7(271):271ra8. doi: 10.1126/scitranslmed.3010257. 10.1126/scitranslmed.3010257 PubMed 25609168