AAV-mOXT-hM3Dq-mCherry-WPRE
(Plasmid #70717)

• Purpose: Expresses DREADDs Gq receptor under oxytocin promoter control
• Depositing Lab: Daniel Geschwind
• Publication: Penagarikano et al Sci Transl Med. 2015 Jan 21;7(271):271ra8. doi: 10.1126/scitranslmed.3010257.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 5142
• Total vector size (bp): 7600
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: hM3Dq-mCherry
• Alt name: DREADDs-mCherry
• Species: H. sapiens (human), Synthetic
• Promoter: mouse oxytocin
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GTTATGCTAGCGCCACCATG
• 3′ sequencing primer: TTACTTGTACAGCTCGTCCATG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: This plasmid is derived as a modification from Addgene Plasmid #44361 - pAAV-hSyn-DIO-hM3D(Gq)-mCherry.
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry