Skip to main content
Addgene

lentiCRISPR - Amplicon, JAK2 sgRNA 2
(Plasmid #70660)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 70660 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    lentiCRISPR v1
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA against JAK2 amplicon found in AML-derived HEL cell line
  • gRNA/shRNA sequence
    GAGGCATATTCTTCTCCTGG
  • Entrez Gene
    JAK2 (a.k.a. JTK10)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCRISPR - Amplicon, JAK2 sgRNA 2 was a gift from David Sabatini (Addgene plasmid # 70660 ; http://n2t.net/addgene:70660 ; RRID:Addgene_70660)
  • For your References section:

    Identification and characterization of essential genes in the human genome. Wang T, Birsoy K, Hughes NW, Krupczak KM, Post Y, Wei JJ, Lander ES, Sabatini DM. Science. 2015 Oct 15. pii: aac7041. 10.1126/science.aac7041 PubMed 26472758