pLV-tetO-Ets2
(Plasmid #70272)

• Purpose: Lentiviral plasmid for tetracycline/doxycycline dependent expression of murine Ets2
• Depositing Lab: Hubert Schorle
• Publication: Kubaczka et al Cell Stem Cell. 2015 Sep 22. pii: S1934-5909(15)00360-4. doi: 10.1016/j.stem.2015.08.005.

Backbone

• Vector backbone: pLV-tetO
• Backbone manufacturer: Hochedlinger Lab (Stadtfeld et al Cell Stem Cell. 2008 Mar 6. 2(3):230-40.)
• Backbone size w/o insert (bp): 8370
• Total vector size (bp): 9830
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ets2
• Alt name: E26 avian leukemia oncogene 2, 3' domain
• Species: M. musculus (mouse)
• Insert Size (bp): 1450
• GenBank ID: NM_011809
• Entrez Gene: Ets2 (a.k.a. Ets-2)
• Promoter: tetO

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CMV-Promoter F: ACGCCATCCACGCTGTTTTGACCT
• 3′ sequencing primer: WPRE-R: CATAGCGTAAAAGGAGCAACA

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The cDNA sequence of murine Ets2 was amplified from undifferentiated trophoblast stem cells and inserted into the pCR2.1 vector. From there it was excised by EcoRI digest and ligated into the pLV-tetO vector via the EcoRI site. The pLV-tetO vector backbone was obtained through EcoRI mediated excision of Oct4 cDNA from pLV-tetO-Oct4 (Stadtfeld et al., 2008, addgene Plasmid #19766), kindly provided by K. Hochedlinger (Harvard University).