pLV-tetO-Gata3
(Plasmid #70270)

• Purpose: Lentiviral plasmid for tetracycline/doxycycline dependent expression of murine Gata3
• Depositing Lab: Hubert Schorle
• Publication: Kubaczka et al Cell Stem Cell. 2015 Sep 22. pii: S1934-5909(15)00360-4. doi: 10.1016/j.stem.2015.08.005.

Backbone

• Vector backbone: pLV-tetO
• Backbone manufacturer: Hochedlinger Lab (Stadtfeld et al Cell Stem Cell. 2008 Mar 6. 2(3):230-40.)
• Backbone size w/o insert (bp): 8370
• Total vector size (bp): 10437
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GATA binding protein 3
• Alt name: Gata3, Gata-3
• Species: M. musculus (mouse)
• Insert Size (bp): 2067
• GenBank ID: NM_008091
• Entrez Gene: Gata3 (a.k.a. Gata-3, jal)
• Promoter: tetO

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CMV-Promoter F: ACGCCATCCACGCTGTTTTGACCT
• 3′ sequencing primer: WPRE-R: CATAGCGTAAAAGGAGCAACA

Resource Information

• Addgene Notes:
  • Addgene diagnostic digest
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The coding sequence for murine Gata3 (together with parts of the 5' and 3' UTR) was inserted into the EcoRI site of the pLV-tetO vector (pLV-tetO vector backbone was obtained through EcoRI mediated excision of Oct4 cDNA from pLV-tetO-Oct4 (Stadtfeld et al., 2008, Addgene Plasmid #19766), kindly provided by K. Hochedlinger (Harvard University)