pLV-tetO-Tfap2c
(Plasmid #70269)

• Purpose: Lentiviral plasmid for tetracycline/doxycycline dependent expression of murine Tfap2c
• Depositing Lab: Hubert Schorle
• Publication: Kubaczka et al Cell Stem Cell. 2015 Sep 22. pii: S1934-5909(15)00360-4. doi: 10.1016/j.stem.2015.08.005.

Backbone

• Vector backbone: pLV-tetO
• Backbone manufacturer: Hochedlinger Lab (Stadtfeld et al Cell Stem Cell. 2008 Mar 6. 2(3):230-40.)
• Backbone size w/o insert (bp): 8370
• Total vector size (bp): 9700
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: transcription factor AP-2, gamma
• Alt name: Tfap2c, AP-2gamma, Tcfap2c
• Species: M. musculus (mouse)
• Insert Size (bp): 1400
• GenBank ID: NM_009335.2
• Entrez Gene: Tfap2c (a.k.a. AP2gamma, Ap-2.2, Stra2, Tcfap2c)
• Promoter: tetO

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CMV-Promoter F: ACGCCATCCACGCTGTTTTGACCT
• 3′ sequencing primer: WPRE-R: CATAGCGTAAAAGGAGCAACA

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The cDNA sequence of murine Tfap2c was inserted into the pLV-tetO vector via the EcoRI site. The pLV-tetO vector backbone was obtained through EcoRI mediated excision of Oct4 cDNA from pLV-tetO-Oct4 (Stadtfeld et al., 2008, addgene Plasmid #19766), kindly provided by K. Hochedlinger (Harvard University).