pHRm-NLS-dCas9-GFP11x7-NLS
(Plasmid #70224)

• Purpose: Expresses NLS-dCas9-GFP11x7-NLS in mammalian cells
• Depositing Lab: Bo Huang
• Publication: Kamiyama et al Nat Commun. 2016 Mar 18;7:11046. doi: 10.1038/ncomms11046.

Backbone

• Vector backbone: pHRdSV40-NLS-dCas9-24xGCN4_v4-NLS-P2A-BFP-dWPRE (addgene #60910)
• Backbone size w/o insert (bp): 8500
• Total vector size (bp): 14000
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NLS-dCas9-GFP11x7-NLS
• Alt name: dCas9-GFP11x7
• Species: Synthetic
• Insert Size (bp): 5599
• Tag / Fusion Protein:
  • GFP11x7 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GCATGCATCTCAATTAGTC
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Articles Citing this Plasmid:
  • 11 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

There is a stop codon found between 7xGFP11 and BFP. BFP expression is not necessary for the imaging system described in the associated publication.