-
PurposeExpresses sfCherry(1-10) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 70222 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1(+)
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 6000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesfCherry(1-10)
-
SpeciesSynthetic
-
Insert Size (bp)627
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer CACAGTCGAGGCTGATCAGCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-sfCherry(1-10) was a gift from Bo Huang (Addgene plasmid # 70222 ; http://n2t.net/addgene:70222 ; RRID:Addgene_70222) -
For your References section:
Versatile protein tagging in cells with split fluorescent protein. Kamiyama D, Sekine S, Barsi-Rhyne B, Hu J, Chen B, Gilbert LA, Ishikawa H, Leonetti MD, Marshall WF, Weissman JS, Huang B. Nat Commun. 2016 Mar 18;7:11046. doi: 10.1038/ncomms11046. 10.1038/ncomms11046 PubMed 26988139