Skip to main content
Addgene

pEGFP-GFP11-Clathrin light chain
(Plasmid #70217)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 70217 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pEGFP-mEmerald-clathrin-15
  • Backbone manufacturer
    Michael Davidson Fluorescent Protein Collection at the UCSF Nikon Imaging center
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 5500
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP11-Clathrin light chain
  • Alt name
    GFP11-Clathrin light chain
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    738
  • Entrez Gene
    CLTA (a.k.a. LCA)
  • Tag / Fusion Protein
    • GFP11 (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TTGCATTCATTTTATGTTTCAGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-GFP11-Clathrin light chain was a gift from Bo Huang (Addgene plasmid # 70217 ; http://n2t.net/addgene:70217 ; RRID:Addgene_70217)

  • For your References section:

    Versatile protein tagging in cells with split fluorescent protein. Kamiyama D, Sekine S, Barsi-Rhyne B, Hu J, Chen B, Gilbert LA, Ishikawa H, Leonetti MD, Marshall WF, Weissman JS, Huang B. Nat Commun. 2016 Mar 18;7:11046. doi: 10.1038/ncomms11046. 10.1038/ncomms11046 PubMed 26988139
Related items:
Commonly requested with: