Skip to main content
Addgene

FUCas9Cherry
(Plasmid #70182)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 70182 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    FUGW
  • Backbone manufacturer
    David Baltimore
  • Modifications to backbone
    FUGW was modified by replacing EGFP coding sequence with Cas9_T2AmCherry
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    humanised S.pyogenes cas9
  • Species
    S.pyogenes
  • Insert Size (bp)
    4290
  • Promoter hUbC
  • Tag / Fusion Protein
    • 3xFLAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (not destroyed)
  • 3′ cloning site BamH1 (destroyed during cloning)
  • 5′ sequencing primer ggcgagtgtgttttgtgaag
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FUCas9Cherry was a gift from Marco Herold (Addgene plasmid # 70182 ; http://n2t.net/addgene:70182 ; RRID:Addgene_70182)

  • For your References section:

    An inducible lentiviral guide RNA platform enables the identification of tumor-essential genes and tumor-promoting mutations in vivo. Aubrey BJ, Kelly GL, Kueh AJ, Brennan MS, O'Connor L, Milla L, Wilcox S, Tai L, Strasser A, Herold MJ. Cell Rep. 2015 Mar 3;10(8):1422-32. doi: 10.1016/j.celrep.2015.02.002. Epub 2015 Feb 26. 10.1016/j.celrep.2015.02.002 PubMed 25732831
Related items:
Commonly requested with: