OPA1-isoform5
(Plasmid
#70177)
-
PurposeMammalian expression of hsOPA1 isoform 5
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 70177 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMSCV-puro
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6300
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehsOPA1 isoform 5
-
Alt nameOptic atrophy 1 protein
-
Alt nameKIAA0567
-
Alt nameDYNAMIN-LIKE 120-KD PROTEIN, MITOCHONDRIAL
-
SpeciesH. sapiens (human)
-
GenBank ID
-
Entrez GeneOPA1 (a.k.a. BERHS, MGM1, MTDPS14, NPG, NTG, largeG)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site HpaI (destroyed during cloning)
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Compared to GenBank reference sequence NM_130834.2, the OPA1 isoform in this plasmid contains a S158N polymorphism/SNP.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
OPA1-isoform5 was a gift from David Chan (Addgene plasmid # 70177 ; http://n2t.net/addgene:70177 ; RRID:Addgene_70177) -
For your References section:
OPA1 processing controls mitochondrial fusion and is regulated by mRNA splicing, membrane potential, and Yme1L. Song Z, Chen H, Fiket M, Alexander C, Chan DC. J Cell Biol. 2007 Aug 27;178(5):749-55. Epub 2007 Aug 20. 10.1083/jcb.200704110 PubMed 17709429