pUG35-YDL183c-GFP
(Plasmid
#70161)
-
Purposeyeast expression of YDL183c with GFP fusion
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 70161 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUG35
- Backbone size w/o insert (bp) 6231
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameYDL183c
-
SpeciesS. cerevisiae (budding yeast)
- Promoter MET17
-
Tag
/ Fusion Protein
- yEGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer pBluescript-SK
- 3′ sequencing primer yGFP-R (GCATCACCTTCACCTTCACC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUG35-YDL183c-GFP was a gift from Karin Nowikovsky (Addgene plasmid # 70161 ; http://n2t.net/addgene:70161 ; RRID:Addgene_70161) -
For your References section:
Novel components of an active mitochondrial K(+)/H(+) exchange. Zotova L, Aleschko M, Sponder G, Baumgartner R, Reipert S, Prinz M, Schweyen RJ, Nowikovsky K. J Biol Chem. 2010 May 7;285(19):14399-414. doi: 10.1074/jbc.M109.059956. Epub 2010 Mar 2. 10.1074/jbc.M109.059956 PubMed 20197279