pENV8(GAAA)-GFPuv
(Plasmid #70128)

• Purpose: Negative control cobalamin riboswitch reporter vector for use in E. coli; deletion of regulatory kissing loop interaction by conversion of L5 to GAAA tetra loop
• Depositing Lab: Robert Batey
• Publication: Johnson JE et al Nature. 2012 Dec 6;492(7427):133-7. doi: 10.1038/nature11607. Epub 2012 Oct 14.

Backbone

• Vector backbone: pBR327
• Backbone size w/o insert (bp): 3273
• Total vector size (bp): 4597
• Modifications to backbone: insertion of riboswitch/GFP reporter in place of the tetracycline resistance gene
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: kissing loop regulatory mutant of environmental cobalamin riboswitch sequence (env8)
• Species: metagenome
• Insert Size (bp): 250
• Promoter: tac
• Tag / Fusion Protein:
  • None

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NsiI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: GTCGTCCCTATCTGCTGCCCTAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The GFPuv reporter came from pGFPUV from Clonetech.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry