pCMV-lyso-pHluorin
(Plasmid #70113)

• Purpose: Expression of lyso-pHluorin in mammalian cells for optical readout of lysosomal acidification
• Depositing Lab: Christian Rosenmund
• Publication: Rost et al Nat Neurosci. 2015 Nov 9. doi: 10.1038/nn.4161.

Backbone

• Vector backbone: pCMV
• Backbone size w/o insert (bp): 3878
• Total vector size (bp): 5336
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL10 Gold
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: lyso-pHluorin
• Alt name: CD63-pHluorin
• Species: M. musculus (mouse); Aequorea victoria
• Insert Size (bp): 3492
• GenBank ID: 12512; KT880226
• Entrez Gene: Cd63 (a.k.a. ME491, Tspan30)
• Promoter: CMV
• Tags / Fusion Proteins:
  • pHluorin
  • HA-Tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: PacI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TTGTGAAATTTGTGATGCTATTGC

Resource Information

• Articles Citing this Plasmid:
  • 8 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry