Skip to main content
Addgene

pCMV-lyso-pHoenix
(Plasmid #70112)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 70112 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCMV
  • Backbone size w/o insert (bp) 3878
  • Total vector size (bp) 7157
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    lyso-pHoenix
  • Alt name
    CD63-pHluorin-Arch3-mKate2-betaHK
  • Species
    M. musculus (mouse), R. norvegicus (rat); Halorubrum sodomense, Entacmaea quadricolor, Aequorea victoria
  • Insert Size (bp)
    3492
  • GenBank ID
    12512; KT880225
  • Entrez Gene
    Cd63 (a.k.a. ME491, Tspan30)
  • Promoter CMV
  • Tags / Fusion Proteins
    • pHluorin
    • Arch3
    • mKate2
    • H+/K+ ATPase beta-subunit
    • HA-Tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site PacI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TTGTGAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Arch3: Addgene Plasmid #22222; mKate2: Evrogen
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-lyso-pHoenix was a gift from Christian Rosenmund (Addgene plasmid # 70112 ; http://n2t.net/addgene:70112 ; RRID:Addgene_70112)
  • For your References section:

    Optogenetic acidification of synaptic vesicles and lysosomes. Rost BR, Schneider F, Grauel MK, Wozny C, G Bentz C, Blessing A, Rosenmund T, Jentsch TJ, Schmitz D, Hegemann P, Rosenmund C. Nat Neurosci. 2015 Nov 9. doi: 10.1038/nn.4161. 10.1038/nn.4161 PubMed 26551543