Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti-Synapsin-pHoenix-WPRE
(Plasmid #70111)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 70111 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    FUGW
  • Backbone size w/o insert (bp) 8400
  • Total vector size (bp) 11892
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    XL10-gold
  • Growth instructions
    Researchers should avoid repetitive freeze-thaw cycles when handling the DNA, as we found that this can lead to DNA degradation. Recommended growth strains are XL10gold and Stbl3.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    pHoenix
  • Alt name
    Synaphtophysin-pHluorin-Arch3-mKate2-betaHK
  • Species
    R. norvegicus (rat); Halorubrum sodomense, Entacmaea quadricolor, Aequorea victoria
  • Insert Size (bp)
    3492
  • GenBank ID
    24804; KT880224
  • Entrez Gene
    Syp (a.k.a. Syp1)
  • Promoter Synapsin
  • Tags / Fusion Proteins
    • pHluorin
    • Arch3
    • mKate2
    • H+/K+ ATPase beta-subunit

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site PacI (not destroyed)
  • 5′ sequencing primer CGCTGCCTCAGTCTGCGGTGG
  • 3′ sequencing primer AGGAGCAACATAGTTAAGAATACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-Synapsin-pHoenix-WPRE was a gift from Christian Rosenmund (Addgene plasmid # 70111 ; http://n2t.net/addgene:70111 ; RRID:Addgene_70111)
  • For your References section:

    Optogenetic acidification of synaptic vesicles and lysosomes. Rost BR, Schneider F, Grauel MK, Wozny C, G Bentz C, Blessing A, Rosenmund T, Jentsch TJ, Schmitz D, Hegemann P, Rosenmund C. Nat Neurosci. 2015 Nov 9. doi: 10.1038/nn.4161. 10.1038/nn.4161 PubMed 26551543