hJAM-A pcDNA3.1
(Plasmid #70073)

• Purpose: Expresses human junctional adhesion molecule-A in mammalian cells
• Depositing Lab: Terence Dermody
• Publication: Danthi et al J Virol. 2006 Feb;80(3):1261-70.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 5500
• Total vector size (bp): 7000
• Vector type: Mammalian Expression
• Selectable markers: Geneticin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: junctional adhesion molecule-A
• Alt name: JAM-A, JAM1, F11R
• Species: H. sapiens (human)
• Insert Size (bp): 1617
• Entrez Gene: F11R (a.k.a. CD321, JAM, JAM1, JAMA, JCAM, KAT, PAM-1)
• Promoter: CMV

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CMV Forward: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: BGH Reverse: TAGAAGGCACAGTCGAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Cloned out of an NT2 cDNA library (Stratagene, La Jolla, CA)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry