pLKO.1-shDnd1-No4
(Plasmid
#70065)
-
PurposeTRC lentiviral vector for shRNA against mouse Dnd1 #4
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 70065 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO.1-TRC cloning vector
-
Backbone manufacturerAddgene #10878
- Backbone size w/o insert (bp) 7032
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameDnd1
-
Alt namedead end homolog 1
-
Alt nameRBMS4
-
Alt nameDND microRNA-mediated repression inhibitor 1
-
gRNA/shRNA sequenceCCGGCAGAGCTTACTATGAATCTTTCTCGAGAAAGATTCATAGTAAGCTCTGTTTTTG
-
SpeciesM. musculus (mouse)
-
Entrez GeneDnd1 (a.k.a. RBMS4, Ter)
- Promoter EF1alpha
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
TRC Clone ID TRCN0000191705
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-shDnd1-No4 was a gift from Thomas Tuschl (Addgene plasmid # 70065 ; http://n2t.net/addgene:70065 ; RRID:Addgene_70065) -
For your References section:
DND1 maintains germline stem cells via recruitment of the CCR4-NOT complex to target mRNAs. Yamaji M, Jishage M, Meyer C, Suryawanshi H, Der E, Yamaji M, Garzia A, Morozov P, Manickavel S, McFarland HL, Roeder RG, Hafner M, Tuschl T. Nature. 2017 Mar 23;543(7646):568-572. doi: 10.1038/nature21690. Epub 2017 Mar 15. 10.1038/nature21690 PubMed 28297718