Skip to main content
Addgene

pLKO.1-shDnd1-No3
(Plasmid #70060)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 70060 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLKO.1-TRC cloning vector
  • Backbone manufacturer
    Addgene #10878
  • Backbone size w/o insert (bp) 7032
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Dnd1
  • Alt name
    dead end homolog 1
  • Alt name
    RBMS4
  • Alt name
    DND microRNA-mediated repression inhibitor 1
  • gRNA/shRNA sequence
    CCGGGTGTTCCTGACCAAGTGTTTACTCGAGTAAACACTTGGTCAGGAACACTTTTTG
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Dnd1 (a.k.a. RBMS4, Ter)
  • Promoter EF1alpha

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer LKO.1 5'
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

TRC Clone ID TRCN0000217928

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-shDnd1-No3 was a gift from Thomas Tuschl (Addgene plasmid # 70060 ; http://n2t.net/addgene:70060 ; RRID:Addgene_70060)

  • For your References section:

    DND1 maintains germline stem cells via recruitment of the CCR4-NOT complex to target mRNAs. Yamaji M, Jishage M, Meyer C, Suryawanshi H, Der E, Yamaji M, Garzia A, Morozov P, Manickavel S, McFarland HL, Roeder RG, Hafner M, Tuschl T. Nature. 2017 Mar 23;543(7646):568-572. doi: 10.1038/nature21690. Epub 2017 Mar 15. 10.1038/nature21690 PubMed 28297718
Related items: