AP568-3
(Plasmid #70048)

• Purpose: co-expression of Cas9 and crRNA 589 target sequence
• Depositing Lab: Geraldine Seydoux
• Publication: Paix et al Genetics. 2015 Sep;201(1):47-54. doi: 10.1534/genetics.115.179382. Epub 2015 Jul 17.

Backbone

• Vector backbone: pDD162
• Backbone manufacturer: Goldstein lab Plasmid 47549
• Vector type: Worm Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: sgRNA for dpy‐10
• gRNA/shRNA sequence: gctaccataggcaccacgag

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: tatgaaatgcctacaccctctc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

From the depositor: Each positive clones had been sequenced for correct insertion of the sgRNA . However the PCR could have created some mutation in the plasmid backbone (containing also the Cas9 gene) and we didnt sequenced the full plasmid, therefore we recommend to use a mix of several positive clones. It is why we provide several clones containing the same sgRNA insert.